January 16, 2002     

The Top 9 Songs in
“Stem Cell: The Musical”

9> I Think We’re a Clone Now

8> Totipotent Eclipse of the Heart

7> De Do Do Do, De DNA

6> AAGGACATACCCAAAGGTTCCGAAGGCATAGC

5> Celling England by the Pound

4> People — People Growing People

3> Zygote You, Babe

2> How Do You Solve a Problem Like Biplexing Mitochondrial
Subluxation?

and the Number 1 Song in “Stem Cell: The Musical”…

1> Seventy-Six Blonde Clones

.

Credits:

Selected from 31 submissions from 12 contributors.
Today’s Top 5 List authors are:

Fran Fruit, Winnetka, IL — 1, RU list name (2nd #1!)
Larry Hollister, Concord, CA — 2, 4
Jonathan P. Bernick, Conway, SC — 3
Dave Berman, San Francisco, CA — 5, 9, Banner tag
Andy Grosser, Boston, MA — 6
Joseph Prisco, Ithaca, NY — 7, 8
Wade Kwon, Birmingham, AL — Topic
Jeffrey Anbinder, New York, NY — Maestro